After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse GLIPR1 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse GLIPR1 cDNA Clone Product Information
Gene_bank_ref_id:NM_028608.3
RefSeq ORF Size:768bp
cDNA Description:Full length Clone DNA of Mus musculus GLI pathogenesis-related 1 (glioma) with N terminal His tag.
Gene Synonym:RTVP1, RTVP-1, mRTVP-1, 2410114O14Rik, Glipr1
Species:Mouse
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Glioma pathogenesis-related protein 1, also known as Protein RTVP-1, GLIPR1 and GLIPR, is a single-pass membrane protein which belongs to the CRISP family. GLIPR1 / RTVP-1 was expressed in high levels in glioblastomas, whereas its expression in low-grade astrocytomas and normal brains was very low. Transfection of glioma cells with small interfering RNAs targeting GLIPR1 / RTVP-1 decreased cell proliferation in all the cell lines examined and induced cell apoptosis in some of them. Overexpression of GLIPR1 / RTVP-1 increased astrocyte and glioma cell proliferation and the anchorage-independent growth of the cells. In addition, overexpression of GLIPR1 / RTVP-1 rendered glioma cells more resistant to the apoptotic effect of tumor necrosis factor-related apoptosis-inducing ligand and serum deprivation. GLIPR1 / RTVP-1 regulated the invasion of glioma cells was evident by their enhanced migration through Matrigel and by their increased invasion in a spheroid confrontation assay. The increased invasive potential of the GLIPR1 / RTVP-1 overexpressors was also shown by the increased activity of matrix metalloproteinase 2 in these cells. The expression of GLIPR1 / RTVP-1 is correlated with the degree of malignancy of astrocytic tumors and that GLIPR1 / RTVP-1 is involved in the regulation of the growth, survival, and invasion of glioma cells. GLIPR1 / RTVP-1 is a potential therapeutic target in gliomas.

References
  • Murphy E.V., et al., 1995, Gene. 159:131-5.
  • Rich T., et al., 1996, Gene. 180:125-30.
  • Rosenzweig,T. et al., 2006, Cancer Res. 66 (8):4139-48.
  • Size / Price
    Catalog: MG50869-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"