After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Rabbit F3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
F3cDNA Clone Product Information
cDNA Size:879
cDNA Description:ORF Clone of Rabbit coagulation factor III (thromboplastin, tissue factor) DNA.
Gene Synonym:F3
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

Tissue factor (TF), also known as coagulation factor III, F3, and CD142, is a single-pass type I membrane protein which belongs to the tissue factor family. Tissue factor is one of the proteins that participate in hemostatic and inflammatory processes. Activated monocytes present in the liver increase expression of tissue factor, and while accumulating in the organ they can intensify inflammation. Tissue factor is the protein that activates the blood clotting system by binding to, and activating, the plasma serine protease, factor VIIa, following vascular injury. Tissue factor is not only the main physiological initiator of normal blood coagulation, but is also important in the natural history of solid malignancies in that it potentiates metastasis and angiogenesis and mediates outside-in signalling. Tissue factor is expressed constitutively by many tissues which are not in contact with blood and by other cells upon injury or activation; the latter include endothelial cells, tissue macrophages, and peripheral blood monocytes. Coagulation Factor III is a transmembrane glycoprotein that localizes the coagulation serine protease factor VII/VIIa (FVII/VIIa) to the cell surface. The primary function of TF is to activate the clotting cascade. The TF:FVIIa complex also activates cells by cleavage of a G-protein coupled receptor called protease-activated receptor 2 (PAR2). TF is expressed by tumor cells and contributes to a variety of pathologic processes, such as thrombosis, metastasis, tumor growth, and tumor angiogenesis. As a key regulator of haemostasis and angiogenesis, it is also involved in the pathology of several diseases, including cardiovascular, inflammatory and neoplastic conditions.

  • Morrissey JH. (2004) Tissue factor: a key molecule in hemostatic and nonhemostatic systems. Int J Hematol. 79(2): 103-8.
  • Milsom C, et al. (2008) Tissue factor and cancer. Pathophysiol Haemost Thromb. 36(3-4): 160-76.
  • Kasthuri RS, et al. (2009) Role of tissue factor in cancer. J Clin Oncol. 27(29): 4834-8.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items