After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse GABARAPL1 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse GABARAPL1 cDNA Clone Product Information
Gene_bank_ref_id:NM_020590.4
RefSeq ORF Size:354bp
cDNA Description:Full length Clone DNA of Mus musculus gamma-aminobutyric acid (GABA) A receptor-associated protein-like 1 with N terminal Myc tag.
Gene Synonym:GECI; Apg8l; Atg8l; AI196471; MNCb-0091; 3110025G09Rik; 9130422N19Rik
Species:Mouse
Vector:pCMV3-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

ATG8, also known as GABARAPL1, is a ubiquitin-like protein which has a crystal structure. ATG8 consists of a 5-stranded β-sheet, which is enclosed by two α-helices at one side and one α-helix at the other side and exhibits a conserved GABARAP domain. It functions in the formation of autophagosomal membranes. The transient conjugation of ATG8 to the autophagosomal membrane through a ubiquitin-like conjugation system is essential for autophagy in eukaryotes. Autophagy is induced upon nutrient depletion or rapamycin treatment and leads to the response of more than 30 autophagy-related (ATG) genes known so far, including ATG8.

References
  • Ohsumi Y, et al. (2004) The crystal structure of microtubule-associated protein light chain 3, a mammalian homologue of Saccharomyces cerevisiae Atg8. Genes Cells. 9(7):611-8.
  • Geng J, et al. (2008) The Atg8 and Atg12 ubiquitin-like conjugation systems in macroautophagy. 'Protein modifications: beyond the usual suspects' review series. EMBO Rep. 9(9):859-644.
  • Suzuki NN, et al. (2005) The crystal structure of plant ATG12 and its biological implication in autophagy. Autophagy. 1(2):119-126.
  • Size / Price
    Catalog: MG52711-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"