Quick Order

Mouse ARSA Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ARSAcDNA Clone Product Information
cDNA Size:1521
cDNA Description:ORF Clone of Mus musculus arylsulfatase A DNA.
Gene Synonym:ASA, As2, AS-A, As-2, TISP73, AW212749, C230037L18Rik
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

Arylsulfatase A (ARSA) is synthesized as a 52KDa lysosomal enzyme. It is a member of the sulfatase family that is required for the lysosomal degradation of cerebroside-3-sulfate, a sphingolipid sulfate ester and a major constituent of the myelin sheet. Arylsulfatase A is activated by a required co- or posttranslational modification with the oxidation of cysteine to formylglycine. Metachromatic leukodystrophy (MLD) is a lysosomal storage disease in the central and peripheral nervous systems with severe and progressive neurological symptoms caused by the deficiency of Arylsulfatase A. Deficiency of this enzyme is also found in apparently healthy individuals, a condition for which the term pseudodeficiency is introduced. ARSA forms dimers after receiving three N-linked oligosaccharides in the endoplasmic reticulum, and then the dimers are transported to the Golgi where they receive mannose 6-phosphate recognition markers. And thus, ARSA is transported and delivered to dense lysosomes in a mannose 6-phosphate receptor-dependent manner. It has been shown that within the lysosomes, the ARSA dimers can oligomerize to an octamer in a pH-dependent manner. The ARSA deficiency leads to metachromatic leucodystrophy (MLD), a lysosomal storage disorder associated with severe and progressive demyelination in he central and peripheral nervous system. Additionally, the serum level of arylsulfatase A might be helpful in diagnosis of lung and central nervous system cancer.

  • Laidler PM. (1991) Arylsulfatase A--physico-chemical properties and the use of enzyme radioimmunoassay in medical diagnosis Folia Med Cracov. 32(3-4): 149-68.
  • Jean S, et al. (2006) Ethanol decreases rat hepatic arylsulfatase A activity levels. Alcohol Clin Exp Res. 30(11): 1950-5.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items