Quick Order

Rat PLAU Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PLAUcDNA Clone Product Information
cDNA Size:1299
cDNA Description:ORF Clone of Rattus norvegicus plasminogen activator, urokinase DNA.
Gene Synonym:UPAM
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

Plasminogen activator, urokinase, also known as PLAU and uPA, is a serine protease which converts plasminogen to plasmin, a broad-spectrum protease active on extracellular matrix (ECM) components. It is involved in complement activation, cell migration, wound healing, and generation of localized extracellular proteolysis during tissue remodelling, pro-hormone conversion, carcinogenesis and neoplasia. Like many components of the blood coagulation, fibrinolytic and complement cascades, uPA has a modular structure, including three conserved domains: a growth factor-like domain (GFD, residues 1-49), a kringle domain (residues 50-131), linked by an interdomain linker or "connecting peptide" (CP, residues 132-158) to the serine protease domain (residues 159-411). uPA and its receptor (uPAR) have been implicated in a broad spectrum of pathophysiological processes, including fibrinolysis, proteolysis, inflammation, atherogenesis and plaque destabilization, all of which are involved in the pathogenesis of MI (myocardial infarction). The role of uPA is not only linked to its action as an enzyme. In fact, the mere binding of uPA on the cell surface also brings about two events that broaden the spectrum of its biological functions: (1) a conformational change of the receptor, which, in turn, affects its interaction with other proteins; (2) a signal transduction which modulates the expression of apoptosis-related genes. Besides its applications as a thrombolytic agent and as a prognostic marker for tumors, uPA may provide the basis for other therapies, as the structure of the receptor-binding domain of uPA has become a model for the design of anti-cancer molecules. Because of the causal involvment of uPA in cancer invasion and metastasis, the blockade of uPA interactions and activity with specific inhibitors is of interest for novel strategies in cancer therapy.

  • Crippa MP. (2007) Urokinase-type plasminogen activator. Int J Biochem Cell Biol. 39(4): 690-4.
  • Kunamneni A, et al. (2008) Urokinase-a very popular cardiovascular agent. Recent Pat Cardiovasc Drug Discov. 3(1): 45-58.
  • Vincenza Carriero M, et al. (2009) Structure, function and antagonists of urokinase-type plasminogen activator. Front Biosci. 14: 3782-94.
  • Xu J, et al. (2010) Association of putative functional variants in the PLAU gene and the PLAUR gene with myocardial infarction. Clin Sci (Lond). 119(8): 353-9.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items