Quick Order

Text Size:AAA

Mouse ANPEP ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse ANPEP cDNA Clone Product Information
Gene_bank_ref_id:NM_008486.1
RefSeq ORF Size:2901bp
cDNA Description:Full length Clone DNA of Mus musculus alanyl (membrane) aminopeptidase with C terminal HA tag.
Gene Synonym:Apn, Cd13, Lap-1, Lap1, p150
Species:Mouse
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Aminopeptidase N (ANPEP or APN), also known as CD13, is a cell-surface metalloprotease located in the small-intestinal and renal microvillar membrane, as well as other plasma membranes. It belongs to the peptidase M1 family. CD13 plays a role in the final digestion of peptides generated from hydrolysis of proteins by gastric and pancreatic proteases and is involved in the metabolism of regulatory peptides by diverse cell types. CD13/APN is a potent regulator of angiogenesis which is essential for tumor invasion and metastasis, and its transcription in activated endothelial cells is induced by angiogenic growth factors via the RAS/MAPK pathway. In addition, this enzyme has been shown to participate in antigen processing and presentation, and accordingly, defects in this gene appear to be a cause of various types of leukemia or lymphoma and carcinomas.

References
  • Pasqualini R, et al. (2000) Aminopeptidase N is a receptor for tumor-homing peptides and a target for inhibiting angiogenesis.Cancer Res. 60(3): 722-7.
  • Mabjeesh SJ, et al. (2005) Aminopeptidase N gene expression and abundance in caprine mammary gland is influenced by circulating plasma peptide. J Dairy Sci. 88(6): 2055-64.
  • Dunkel B, et al. (2009) Neutrophil and platelet activation in equine recurrent airway obstruction is associated with increased neutrophil CD13 expression, but not platelet CD41/61 and CD62P or neutrophil-platelet aggregate formation. Vet Immunol Immunopathol. 131(1-2): 25-32.
  • Size / Price
    Catalog: MG50001-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"