Quick Order

Mouse SIGLEC5 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SIGLEC5cDNA Clone Product Information
cDNA Size:1710
cDNA Description:ORF Clone of Mus musculus sialic acid binding Ig-like lectin 5 DNA.
Gene Synonym:Siglecf, mSiglec-F
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

SIGLEC5 contains 2 Ig-like C2-type (immunoglobulin-like) domains and 1 Ig-like V-type (immunoglobulin-like) domain. It belongs to the immunoglobulin superfamily and SIGLEC (sialic acid binding Ig-like lectin) family. SIGLEC5 is expressed by monocytic/myeloid lineage cells. It is found at high levels in peripheral blood leukocytes, spleen, bone marrow and at lower levels in lymph node, lung, appendix, placenta, pancreas and thymus. It is also expressed by monocytes and neutrophils but absent from leukemic cell lines representing early stages of myelomonocytic differentiation. SIGLEC5 is a putative adhesion molecule that mediates sialic-acid dependent binding to cells. It binds equally to alpha-2,3-linked and alpha-2,6-linked sialic acid. The sialic acid recognition site may be masked by cis interactions with sialic acids on the same cell surface.

  • Angata T, et al. (2006) Discovery of Siglec-14, a novel sialic acid receptor undergoing concerted evolution with Siglec-5 in primates. FASEB J. 20(12):1964-73.
  • Avril T, et al. (2005) Siglec-5 (CD170) can mediate inhibitory signaling in the absence of immunoreceptor tyrosine-based inhibitory motif phosphorylation. J Biol Chem. 280(20):19843-51.
  • Erickson-Miller CL, et al. (2003) Characterization of Siglec-5 (CD170) expression and functional activity of anti-Siglec-5 antibodies on human phagocytes. Exp Hematol. 31(5):382-8.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items