Quick Order

Text Size:AAA

Mouse MAPK14 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse MAPK14 cDNA Clone Product Information
Gene_bank_ref_id:NM_011951.3
RefSeq ORF Size:1083bp
cDNA Description:Full length Clone DNA of Mus musculus mitogen-activated protein kinase 14 with N terminal His tag.
Gene Synonym:p38, Crk1, Mxi2, p38a, CSBP2, Csbp1, PRKM14, PRKM15, p38MAPK, p38alpha, MGC102436, p38-alpha, Mapk14
Species:Mouse
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

MAPK14 contains 1 protein kinase domain and belongs to the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. MAPK14 can be detected in brain, heart, placenta, pancreas and skeletal muscle and it is expressed to a lesser extent in lung, liver and kidney. MAPK14 is activated by various environmental stresses and proinflammatory cytokines. The activation requires its phosphorylation by MAP kinase kinases (MKKs), or its autophosphorylation triggered by the interaction of MAP3K7IP1/TAB1 protein with MAPK14. The substrates of p38 alpha include transcription regulator ATF2, MEF2C, and MAX, cell cycle regulator CDC25B, and tumor suppressor p53, which suggest the roles of p38 alpha in stress related transcription and cell cycle regulation, as well as in genotoxic stress response. In respond to activation by environmental stress, pro-inflammatory cytokines and lipopolysaccharide, MAPK14 phosphorylates a number of transcription factors, such as ELK1 and ATF2 and several downstream kinases, such as MAPKAPK2 and MAPKAPK5. MAPK14 plays a critical role in the production of some cytokines, for example IL-6. It may play a role in stabilization of EPO mRNA during hypoxic stress. Isoform Mxi2 activation is stimulated by mitogens and oxidative stress and only poorly phosphorylates ELK1 and ATF2.

References
  • Luo X, et al. (2011) Study on p38 mitogen activated protein kinase in vascular endothelial cells dysfunction in preeclampsia. Zhonghua Fu Chan Ke Za Zhi. 46(1):36-40.
  • Park CH, et al. (2011) Epidermal growth factor-induced matrix metalloproteinase-1 expression is negatively regulated by p38 MAPK in human skin fibroblasts. J Dermatol Sci. 64(2):134-41.
  • Lee JY, et al. (2011) Curcumin induces EGFR degradation in lung adenocarcinoma and modulates p38 activation in intestine: the versatile adjuvant for gefitinib therapy. PLoS One. 6(8):e23756.
  • Riis JL, et al. (2011) CCL27 expression is regulated by both p38 MAPK and IKKβ signalling pathways. Cytokine. 56(3):699-707.
  • Size / Price
    Catalog: MG50825-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"