After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse TXN1 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse TXN cDNA Clone Product Information
Gene_bank_ref_id:NM_011660.3
RefSeq ORF Size:318bp
cDNA Description:Full length Clone DNA of Mus musculus thioredoxin 1 with N terminal His tag.
Gene Synonym:ADF, Txn, Trx1, AW550880, Txn1
Species:Mouse
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Thioredoxin, also known as ATL-derived factor, Surface-associated sulphydryl protein, SASP and TXN, is a nucleus, cytoplasm and secreted protein which belongs to the thioredoxin family. Thioredoxins are proteins that act as antioxidants by facilitating the reduction of other proteins by cysteine thiol-disulfide exchange. Thioredoxins are found in nearly all known organisms and are essential for life in mammals. Thioredoxin / TXN participates in various redox reactions through the reversible oxidation of its active center dithiol to a disulfide and catalyzes dithiol-disulfide exchange reactions. Thioredoxin / TXN plays a role in the reversible S-nitrosylation of cysteine residues in target proteins, and thereby contributes to the response to intracellular nitric oxide. Thioredoxin / TXN nitrosylates the active site Cys of CASP3 in response to nitric oxide (NO), and thereby inhibits caspase-3 activity. Thioredoxin / TXN induces the FOS/JUN AP-1 DNA-binding activity in ionizing radiation (IR) cells through its oxidation/reduction status and stimulates AP-1 transcriptional activity.

References
  • Holmgren A , et al.,1989, J Biol Chem 264 (24): 13963-6.
  • Nordberg J, et al., 2001, Free Radic Biol Med31 (11): 1287-312.
  • Mustacich D, et al., 2000, Biochem J 346 (Pt 1): 1-8. 
  • Mitchell D.A., et al., 2005, Nat. Chem. Biol. 1:154-158.
  • Size / Price
    Catalog: MG50822-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"