Quick Order

Mouse CSNK2A1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CSNK2A1cDNA Clone Product Information
cDNA Size:1176
cDNA Description:ORF Clone of Mus musculus casein kinase 2, alpha 1 polypeptide DNA.
Gene Synonym:MGC102141, Csnk2a1-rs4, Csnk2a1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-His Vector Information
Vector Name pCMV3-N-His
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-His Physical Map

Schematic of pCMV3-N-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Mouse CSNK2A1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged on other vectors
Related Products
Product nameProduct name

Casein kinase II subunit alpha, also known as CK II alpha, CSNK2A1 and CK2A1, is a member of the protein kinase superfamily, Ser / Thr protein kinase family and CK2 subfamily. Casein kinase II (CSNK2A1) is a serine / threonine protein kinase that phosphorylates acidic proteins such as casein. This kinase is composed of an alpha, an alpha-prime, and two beta subunits. The alpha subunits contain the catalytic activity while the beta subunits undergo autophosphorylation. Casein kinase II (CSNK2A1) is a constitutively active, ubiquitously expressed serine / threonine protein kinase that is thought to have a regulatory function in cell proliferation, cell differentiation and apoptosis. CSNK2A1 functions as a tetrameric complex consisting of two regulatory beta-subunits and two catalytic units (alpha and alpha') in a homomeric or heteromeric conformation. Whilst the alpha- and alpha'-subunits are catalytically identical, proteins that regulate CSNK2A1, such as cdc2 and Hsp90, preferentially bind to the alpha and not the alpha'-subunit. CSNK2A1 can phosphorylate a number of key intracellular signaling proteins implicated in tumor suppression (p53 and PTEN) and tumorigenesis (myc, jun, NF-kappaB). CSNK2A1 is also thought to influence Wnt signaling via beta-catenin phosphorylation and the PI 3-K signaling pathway via th phosphorylation of Akt.

  • Schlpfer J, et al. (1997) A radiation hybrid framework map of bovine chromosome 13. Chromosome Res. 5(8): 511-9.
  • Wirkner U, et al. (1994) The human gene (CSNK2A1) coding for the casein kinase II subunit alpha is located on chromosome 20 and contains tandemly arranged Alu repeats. Genomics. 19(2): 257-65.
  • Wirkner U, et al. (1998) Genomic organization and promoter identification of the human protein kinase CK2 catalytic subunit alpha (CSNK2A1). Genomics. 48(1): 71-8.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks