Quick Order

Text Size:AAA

Mouse KLRB1F ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse KLRB1F cDNA Clone Product Information
Gene_bank_ref_id:NM_153094.2
RefSeq ORF Size:654bp
cDNA Description:Full length Clone DNA of Mus musculus killer cell lectin-like receptor subfamily B member 1F with N terminal His tag.
Gene Synonym:Nkrp1f, Nkr-p1f, Nkrp1-f, MGC130065, MGC130066, A630024B12Rik, Klrb1f
Species:Mouse
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
References
  • Kveberg L, et al. (2011) Phylogenetic and functional conservation of the NKR-P1F and NKR-P1G receptors in rat and mouse. Immunogenetics. 63(7): 429-36.
  • Aust JG, et al. (2009) The expression and function of the NKRP1 receptor family in C57BL/6 mice. J Immunol. 183(1): 106-16.
  • Tian W, et al. (2005) C-type lectin OCILRP2/Clr-g and its ligand NKRP1f costimulate T cell proliferation and IL-2 production. Cell Immunol. 234(1): 39-53.
  • Plougastel B, et al. (2001) Analysis of a 1-Mb BAC contig overlapping the mouse Nkrp1 cluster of genes: cloning of three new Nkrp1 members, Nkrp1d, Nkrp1e, and Nkrp1f. Immunogenetics. 53(7): 592-8.
  • Size / Price
    Catalog: MG50815-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"