Quick Order

Text Size:AAA

Mouse KLRB1A ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse KLRB1A cDNA Clone Product Information
NCBI RefSeq:NM_010737.3
RefSeq ORF Size:702bp
cDNA Description:Full length Clone DNA of Mus musculus killer cell lectin-like receptor subfamily B member 1A with N terminal His tag.
Gene Synonym:Ly55a, NKRP12, Nkrp1a, NKR-P1A, Nkrp1-a, Klrb1a
Species:Mouse
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
References
  • Plougastel B, et al. (2001) Analysis of a 1-Mb BAC contig overlapping the mouse Nkrp1 cluster of genes: cloning of three new Nkrp1 members, Nkrp1d, Nkrp1e, and Nkrp1f. Immunogenetics 53: 592-598.
  • Kogelberg H, et al. (2000) Expression in Escherichia coli, folding in vitro, and characterization of the carbohydrate recognition domain of the natural killer cell receptor NKR-P1A. Protein Expr Purif. 20(1): 10-20.
  • Grazia Cifone M, et al. (1997) NKR-P1A stimulation of arachidonate-generating enzymes in rat NK cells is associated with granule release and cytotoxic activity. J Immunol. 159(1): 309-17.
  • Josien R, et al. (1997) Rat spleen dendritic cells express natural killer cell receptor protein 1 (NKR-P1) and have cytotoxic activity to select targets via a Ca2+-dependent mechanism. J Exp Med. 186: 467-472.
  • Ryan JC, et al. (1995) NKR-P1A is a target-specific receptor that activates natural killer cell cytotoxicity. J Exp Med. 181(5): 1911-5.
  • Lanier L L, et al. (1994) Human NKR-P1A: a disulfide-linked homodimer of the C-type lectin superfamily expressed by a subset of NK and T lymphocytes. J Immunol. 153: 2417-2428.
  • Chambers W, et al. (1989) Monoclonal antibody to a triggering structure expressed on rat natural killer cells and adherent lymphokine-activated killer cells. J Exp Med. 169: 1373-1389.
  • Size / Price
    Catalog: MG50806-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"