Quick Order

Mouse XIAP / BIRC4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
XIAPcDNA Clone Product Information
cDNA Size:1491
cDNA Description:ORF Clone of Mus musculus X-linked inhibitor of apoptosis DNA.
Gene Synonym:Aipa, Api3, IAP3, MIHA, Birc4, ILP-1, mXIAP, 1110015C02Rik, Xiap
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-His Vector Information
Vector Name pCMV3-N-His
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-His Physical Map

Schematic of pCMV3-N-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Mouse XIAP / BIRC4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged on other vectors
Related Products
Product nameProduct name

E3 ubiquitin-protein ligase XIAP / BIRC4, also known as inhibitor of apoptosis protein 3, X-linked inhibitor of apoptosis protein, and IAP-like protein, is a protein that belongs to a family of apoptotic suppressor proteins. Members of this family share a conserved motif termed, baculovirus IAP repeat, which is necessary for their anti-apoptotic function. XIAP / BIRC4 functions through binding to tumor necrosis factor receptor-associated factors TRAF1 and TRAF2 and inhibits apoptosis induced by menadione, a potent inducer of free radicals, and interleukin 1-beta converting enzyme. XIAP / BIRC4 also inhibits at least two members of the caspase family of cell-death proteases, caspase-3 and caspase-7. Mutations in this encoding gene are the cause of X-linked lymphoproliferative syndrome. Alternate splicing results in multiple transcript variants. Thought to be the most potent apoptosis suppressor, XIAP / BIRC4, directly binds and inhibits caspases -3, -7 and -9. Survivin, which also binds to several caspases, is up-regulated in a many tumour cell types. Defects in XIAP / BIRC4 are the cause of lymphoproliferative syndrome X-linked type 2 (XLP2). XLP is a rare immunodeficiency characterized by extreme susceptibility to infection with Epstein-Barr virus (EBV). Symptoms include severe or fatal mononucleosis, acquired hypogammaglobulinemia, pancytopenia and malignant lymphoma.

  • Holcik M, et al. (2000) Functional Characterization of the X-Linked Inhibitor of Apoptosis (XIAP) Internal Ribosome Entry Site Element: Role of La Autoantigen in XIAP Translation. Mol Cell Biol. 20 (13): 4648-57.
  • Winsauer G, et al. (2008) XIAP regulates bi-phasic NF-kappaB induction involving physical interaction and ubiquitination of MEKK2. Cell Signal. 20 (11): 2107-12.
  • Suzuki Y, et al. (2001) X-linked inhibitor of apoptosis protein (XIAP) inhibits caspase-3 and -7 in distinct modes. J Biol Chem. 276 (29): 27058-63.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks