Quick Order

Text Size:AAA

Mouse DDC Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
DDCcDNA Clone Product Information
cDNA Size:1443
cDNA Description:ORF Clone of Mus musculus dopa decarboxylase DNA.
Gene Synonym:Aadc, Ddc
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-His Vector Information
Vector Name pCMV3-N-His
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-His Physical Map

Schematic of pCMV3-N-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

Dopa Decarboxylase (DDC), also known as AADC and Aromatic-L-amino acid decarboxylase, is a 54 kDa member of the group II decarboxylase family of proteins.It is a vitamin B6-dependent homodimeric enzyme that catalyzes the decarboxylation of both L-3,4-dihydroxyphenylalanine (L-DOPA) and L-5-hydroxytryptophan to dopamine and serotonin, respectively, which are major mammalian neurotransmitters and hormones belonging to catecholamines and indoleamines. Since L-DOPA is regularly used to treat the symptoms of Parkinson's disease, the catalytic pathway is of particular research interest. Defects of DDC are associated with severe developmental delay, oculogyric crises (OGC), as well as autosomal recessive disorder AADC deficiency, an early onset inborn error in neurotransmitter metabolism which can lead to catecholamine and serotonin deficiency.

  • Ichinose, H. et al.,1989,Biochem. Biophys. Res. Commun. 164: 1024-1030.
  • Lisa, J. S. et al., 1992, Genomics 13: 469-471.
  • Moore, P. S. et al.,1996, Biochem. J. 315:249-256.
  • Bertoldi, M. et al., 2003, Biochim. Biophys. Acta. 1647:42-47.
  • Vassilacopoulou, D. et al., 2004, Neurochem. Res. 29: 1817-1823.
  • Ma, J.Z., et al., 2005, Hum. Mol. Genet. 14: 1691-1698.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items