Quick Order

Mouse CTSS Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CTSScDNA Clone Product Information
cDNA Size:1023
cDNA Description:ORF Clone of Mus musculus cathepsin S DNA.
Gene Synonym:Ctss
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

Cathepsin S (CTSS), one of the lysosomal proteinases, has many important physiological functions in the nervous system, especially in process of extracellular matrix degradation and endocellular antigen presentation. CTSS is synthesized as inactive precursor of 331 amino acids consisting of a 15-aa signal peptide, a propeptide of 99 aa, and a mature polypeptide of 217 aa. It is activated in the lysosomes by a proteolytic cleavage of the propeptide. Cathepsin S is expressed in the lysosome of antigen presenting cells, primarily dendritic cells, B-cells and macrophages. Compared with other lysosomal cysteine proteases, cathepsin S has displayed some unique characteristics. Cathepsin S is most well known for its critical function in the proteolytic digestion of the invariant chain chaperone molecules, thus controlling antigen presentation to CD4+ T-cells by major histocompatibility complex (MHC) class II molecules or to NK1.1+ T-cells via CD1 molecules. Cathepsin S also appears to participate in direct processing of exogenous antigens for presentation by MHC class II to CD4+ T-cells, or in cross-presentation by MHC class I molecules to CD8+ T-cells. In addition, although direct evidence is still lacking, in its secreted form cathepsin S is implicated in degradation of the extracellular matrix, which may contribute to the pathology of a number of diseases, including arthritis, atherosclerosis, neurological diseases and chronic obstructive pulmonary disease.

  • Liu W, et al. (2004) Cysteine protease cathepsin S as a key step in antigen presentation. Drug News Perspect. 17(6): 357-63.
  • Thurmond RL, et al. (2005) Cathepsin S inhibitors as novel immunomodulators. Curr Opin Investig Drugs. 6(5): 473-82.
  • Wang DM, et al. (2008) Cathepsin S in pathogenesis of neurological diseases. Zhejiang Da Xue Xue Bao Yi Xue Ban. 37(4): 422-6.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items