Quick Order

Mouse LILRB3 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse LILRB3 cDNA Clone Product Information
Gene_bank_ref_id:NM_011095.1
RefSeq ORF Size:2526bp
cDNA Description:Full length Clone DNA of Mus musculus leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 3 with N terminal His tag.
Gene Synonym:Gp91, Pirb, Lilrb3
Species:Mouse
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Leukocyte immunoglobulin-like receptor subfamily B member 3, also known as Leukocyte immunoglobulin-like receptor 3, Immunoglobulin-like transcript 5, Monocyte inhibitory receptor HL9, CD85 antigen-like family member A, CD85a and LILRB3, is a single-pass type I  membrane protein which belongs to the leukocyte receptor cluster (LRC) present on 19q13.4. LILRB3 / CD85a contains four Ig-like C2-type (immunoglobulin-like) domains. LILRB3 / CD85a contains three copies of a cytoplasmic motif that is referred to as the immunoreceptor tyrosine-based inhibitor motif (ITIM). This motif is involved in modulation of cellular responses. The phosphorylated ITIM motif can bind the SH2 domain of several SH2-containing phosphatases. LILRB3 / CD85a is expressed on immune cells where it binds to MHC class I molecules on antigen-presenting cells and transduces a negative signal that inhibits stimulation of an immune response. It is thought to control inflammatory responses and cytotoxicity to help focus the immune response and limit autoreactivity. Multiple transcript variants encoding different isoforms have been found.

References
  • Huang,J. et al., 2010, J Virol. 84 (18): 9463-71.
  • Arm J.P. et al., 1997, J. Immunol. 159:2342-2349.
  • Wende H. et al., 2000, Immunogenetics 51:703-713.
  • Yu L.-R. et al., 2007,J. Proteome Res. 6:4150-4162.
  • Size / Price
    Catalog: MG50760-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"