Quick Order

Mouse CD84 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse CD84 cDNA Clone Product Information
Gene_bank_ref_id:NM_013489.2
RefSeq ORF Size:990bp
cDNA Description:Full length Clone DNA of Mus musculus CD84 antigen with N terminal His tag.
Gene Synonym:CDw84, SLAMF5, A130013D22Rik, Cd84
Species:Mouse
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

The CD2 family receptors are type I transmembrane glycoproteins belonging to immunoglobulin (Ig) superfamily characterized by a membrane-proximal Ig constant 2 (C2) domain and a membrane-distal variable (V) domain that is responsible for ligand recognition. CD84, also known as LY9B and SLAMF5, is a homophilic member of the SLAM (signaling lymphocyte activation molecule) subfamily of the CD2 family. The SLAM family receptorsmediate signal transduction through the interaction of its ITSM (immunoreceptor tyrosine-based switch motifs) in the intracellular region and the SH2 domain of adaptor molecules SAP (SLAM-associated protein) and EAT-2 (EWS-activated transcript 2), and accordingly modulate both adaptive and innate immune responses. The CD84-CD84 interaction was independent of its cytoplasmic tail. Thus, CD84 is its own ligand and acts as a costimulatory molecule. CD84 is expressed on cells from almost all hematopoietic lineages and on CD34+ hematopoietic progenitor cells, suggesting that CD84 serves as a marker for committed hematopoietic progenitor cells.

References
  • Martin M, et al. (2001) CD84 functions as a homophilic adhesion molecule and enhances IFN-gamma secretion: adhesion is mediated by Ig-like domain 1. J Immunol. 167(7): 3668-76.
  • Tangye SG, et al. (2002) CD84 is up-regulated on a major population of human memory B cells and recruits the SH2 domain containing proteins SAP and EAT-2. Eur J Immunol. 32(6): 1640-9.
  • Zaiss M, et al. (2003) CD84 expression on human hematopoietic progenitor cells. Exp Hematol. 31(9): 798-805.
  • Tangye SG, et al. (2003) Functional requirements for interactions between CD84 and Src homology 2 domain-containing proteins and their contribution to human T cell activation. J Immunol. 171(5): 2485-95.
  • Yan Q, et al. (2007) Structure of CD84 provides insight into SLAM family function. Proc Natl Acad Sci U S A. 104(25): 10583-8.
  • Size / Price
    Catalog: MG50757-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"