Quick Order

Rat TSC22D1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
TSC22D1cDNA Clone Product Information
Gene_bank_ref_id:NM_013043.2
cDNA Size:432
cDNA Description:ORF Clone of Rattus norvegicus TSC22 domain family, member 1 DNA.
Gene Synonym:TS22A, TSC-22, Tgfb1i4
Species:Rat
Vector:pCMV3-C-FLAG
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
 
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name
Background

TSC22 domain family, member 1 (TSC22D1) is one of the TGF-beta-stimulated clone-22 (TSC-22). TSC-22 was reported to be a differentiation-inducing factor which negatively regulates the growth of salivary gland cancer cells. TSC22D1, which encodes transforming growth factor beta-stimulated clone 22 (TSC-22), is thought to be a tumor suppressor because its expression is lost in many glioblastoma, salivary gland, and prostate cancers. TSC-22 is the founding member of the TSC-22/DIP/Bun family of leucine zipper transcription factors. TSC-22 may play an important role in maintaining the differentiated phenotype in salivary gland tumors, and may be a possible target of leukemia therapy. TSC22D1 forms homodimers via its conserved leucine zipper domain and heterodimerizes with TSC22D4. TSC22D1 has transcriptional repressor activity.

References
  • Doi Y, et al. (2008) Expression and cellular localization of TSC-22 in normal salivary glands and salivary gland tumors: implications for tumor cell differentiation. Oncol Rep. 19(3): 609-16.
  • Wu X, et al. (2008) The Drosophila homolog of human tumor suppressor TSC-22 promotes cellular growth, proliferation, and survival. Proc Natl Acad Sci U S A. 105(14): 5414-9.
  • Lu Y, et al. (2007) Identification of TSC-22 as a potential tumor suppressor that is upregulated by Flt3-D835V but not Flt3-ITD. Leukemia. 21(11): 2246-57.
  • Size / Price
    Catalog:RG81159-CF
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"