Quick Order

Mouse PFN2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PFN2cDNA Clone Product Information
cDNA Size:423
cDNA Description:ORF Clone of Mus musculus profilin 2 DNA.
Gene Synonym:Pfn
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

Profilin 2, also known as PFN2, is a ubiquitous actin monomer-binding protein belonging to the profilin family. It is highly expressed in brain, skeletal muscle and kidney and less strongly in heart, placenta, lung and liver. Profilin 2 binds to actin and affects the structure of the cytoskeleton. At high concentrations, profilin prevents the polymerization of actin, whereas it enhances it at low concentrations. Profilin 2 is thought to regulate actin polymerization in response to extracellular signals. It inhibits the formation of IP3 and DG by binding to PIP2.

  • Da Silva. et al., 2003, J Cell Biol. 162 (7): 1267-79.
  • Honore B. et al., 1993, FEBS Lett. 330 (2): 151-5.
  • Joensuu T. et al., 1997, Genomics. 38 (3): 255-63.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items