After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse METRN ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse METRN cDNA Clone Product Information
Gene_bank_ref_id:NM_133719.2
RefSeq ORF Size:876bp
cDNA Description:Full length Clone DNA of Mus musculus meteorin, glial cell differentiation regulator with N terminal His tag.
Gene Synonym:Hyrac, 1810034B16Rik, Metrn
Species:Mouse
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Meteorin is a novel secreted protein that is expressed in undifferentiated neural progenitors and in the astrocyte lineage, including radial glia. It plays important roles in the differentiation of glial cells and also in axonal network formation during neurogenesis. Meteorin selectively promoted astrocyte formation from mouse cerebrocortical neurospheres in differentiation culture, whereas it induced cerebellar astrocytes to become radial glia. Meteorin also induced axonal extension in small and intermediate neurons of sensory ganglia by activating nearby satellite glia.

References
  • Martin J, et al. (2004) The sequence and analysis of duplication-rich human chromosome 16. Nature. 432(7020):988-94.
  • Nishino J, et al. (2004) Meteorin: a secreted protein that regulates glial cell differentiation and promotes axonal extension. EMBO J. 23(9):1998-2008.
  • Ota T, et al. (2004) Complete sequencing and characterization of 21,243 full-length human cDNAs. Nat Genet. 36(1):40-5.
  • Size / Price
    Catalog: MG50605-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"