Quick Order

Text Size:AAA

Mouse SDPR Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SDPRcDNA Clone Product Information
cDNA Size:1257
cDNA Description:ORF Clone of Mus musculus serum deprivation response DNA.
Gene Synonym:Sdpr
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-His Vector Information
Vector Name pCMV3-N-His
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-His Physical Map

Schematic of pCMV3-N-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

Mouse Serum deprivation-response protein, also known as Phosphatidylserine-binding protein, Cavin-2 and SDPR, is a member of the PTRF / SDPR family. SDPR is highly expressed in heart and lung, and expressed at lower levels in brain, kidney, liver, pancreas, placenta, and skeletal muscle. SDPR is a new regulator of caveolae biogenesis. SDPR is up-regulated in asyncronously growing fibroblasts following serum deprivation but not following contact inhibition and Down-regulated during synchronous cell cycle re-entry. Caveolae are plasma membrane invaginations with a characteristic flask-shaped morphology. They function in diverse cellular processes, including endocytosis. Loss of SDPR causes loss of caveolae. SDPR binds directly to PTRF and recruits PTRF to caveolar membranes. Overexpression of SDPR, unlike PTRF, induces deformation of caveolae and extensive tubulation of the plasma membrane. SDPR overexpression results in increased caveolae size and leads to the formation of caveolae-derived tubules containing Shiga toxin. SDPR is a membrane curvature inducing component of caveolae, and that STB-induced membrane tubulation is facilitated by caveolae. Pleckstrin and SDPR are phosphorylated by protein kinase C (PKC), the interaction between pleckstrin and SDPR was shown to be independent of PKC inhibition or activation. SDPR may facilitate the translocation of nonphosphorylated pleckstrin to the plasma membrane in conjunction with phosphoinositides that bind to the C-terminal PH domain.

  • Li,X. et al., 2008, Cancer Sci. 99 (7):1326-33.
  • Hansen,C.G. et al., 2009, Nat Cell Biol. 11 (7):807-14.
  • Baig,A. et al., 2009, Platelets. 20 (7):446-57.
  • Nabi,IR. et al., 2009, Nat Cell Biol.11 (7):789-91.