Quick Order

Mouse TXNDC17 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse TXNDC17 cDNA Clone Product Information
Gene_bank_ref_id:NM_026559.3
RefSeq ORF Size:372bp
cDNA Description:Full length Clone DNA of Mus musculus thioredoxin domain containing 17 with C terminal His tag.
Gene Synonym:TRP14, Txnl5, D11Ertd672e, 4831443O22Rik, RP23-207N15.4
Species:Mouse
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
References
  • Holmgren A. (1985) Thioredoxin. Annu Rev Biochem. 54: 237-71.
  • Holmgren A. (1995) Thioredoxin structure and mechanism: conformational changes on oxidation of the active-site sulfhydryls to a disulfide. Structure. 3 (3): 239-43.
  • Martin JL. (1995) Thioredoxin--a fold for all reasons. Structure. 3 (3): 245-50.
  • Size / Price
    Catalog: MG51578-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"