Quick Order

Human DCUN1D1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
DCUN1D1cDNA Clone Product Information
cDNA Size:780
cDNA Description:ORF Clone of Homo sapiens DCN1, defective in cullin neddylation 1, domain containing 1 (S. cerevisiae) DNA.
Gene Synonym:RP42, SCRO, Tes3, DCNL1, SCCRO, DCUN1L1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-HA Vector Information
Vector Name pCMV3-N-HA
Vector Size 6101bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-HA Physical Map
Schematic of pCMV3-N-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human DCUN1D1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged on other vectors
Related Products
Product nameProduct name

DCUN1D1, also known as SCCRO, is part of an E3 ubiquitin ligase complex for neddylation. DCUN1D1 functions to recruit charged E2 and is involved in the release of inhibitory effects of CAND1 on cullin-RING ligase E3 complex assembly and activity. DCUN1D1 binds to the components of the neddylation pathway (Cullin-ROC1, Ubc12, and CAND1) and augments but is not required for cullin neddylation in reactions using purified recombinant proteins. DCUN1D1 also recruits Ubc12 approximately NEDD8 to the CAND1-Cul1-ROC1 complex but that this is not sufficient to dissociate or overcome the inhibitory effects of CAND1 on cullin neddylation in purified protein assays. DCUN1D1 also acts as am ncogene facilitating malignant transformation and carcinogenic progression.

  • Heir P. et al., 2013, Mol Cell Biol. 33 (8): 1621-31.
  • Kurz T. et al., 2005, Nature. 435 (7046): 1257-61.
  • Kim AY. et al., 2008, J Biol Chem. 283 (48): 33211-20.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items