After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse FETUB ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse FETUB cDNA Clone Product Information
Gene_bank_ref_id:NM_001083904.1
RefSeq ORF Size:1167bp
cDNA Description:Full length Clone DNA of Mus musculus fetuin beta with N terminal His tag.
Gene Synonym:Gugu, D17980, AI255764
Species:Mouse
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Fetuin-B, also known as Fetuin-like protein IRL685 and FETUB, is a secreted protein which belongs to the fetuin family. Fetuin-B / FETUB contains two cystatin domains. Fetuin-B is a member of the fetuin family, part of the cystatin superfamily of cysteine protease inhibitors. Fetuins have been implicated in several diverse functions, including osteogenesis and bone resorption. Fetuin-A has been identified as a major protein during fetal life and is also involved in important functions such as protease inhibitory activities and development-associated regulation of calcium metabolism and osteogenesis. Fetuin-A is a key partner in the recovery phase of an acute inflammatory response. Fetuin-B / FETUB is found at least in human and rodents. It is unambiguously a paralogue of Fetuin-A. Fetuin-A and Fetuin-B exhibit significant differences at the amino acid sequence level, notably including variations with respect to the archetypal fetuin-specific signature.

References
  • Olivier E., et al., 2000, Biochem. J. 350:589-97
  • Liu T., et al., 2005, J. Proteome Res. 4:2070-80.
  • Hsu SJ, et al., 2005, Genome. 47 (5): 931-46.
  • Liu T, et al., 2006, J. Proteome Res.4 (6): 2070-80.
  • Size / Price
    Catalog: MG50572-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"