Quick Order

Mouse ADK ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse ADK cDNA Clone Product Information
Gene_bank_ref_id:NM_001243041.1
RefSeq ORF Size:1038bp
cDNA Description:Full length Clone DNA of Mus musculus adenosine kinase with C terminal His tag.
Gene Synonym:Ak, AI255373, AI987814, 2310026J05Rik, 5033405D03Rik
Species:Mouse
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

Adenosine kinase(ADK) belongs to the family of transferases. Adenosine kinase (ADK) is the key enzyme in adenosine metabolism and catalyzes ATP and adenosine into two products: ADP and AMP. Two isoforms of the enzyme adenosine kinase (ADK), which differ at their N-terminal ends, are found in mammalian cells. It has been shown that the two ADK isoforms differ only in their first exons and the promoter regions; hence they arise via differential splicing of their first exons with the other exons common to both isoforms. In adult brain, ADK is primarily present in astrocytes. Several lines of experimental evidence support a critical role of ADK in different types of brain injury associated with astrogliosis, which is also a prominent morphologic feature of temporal lobe epilepsy (TLE). It has been suggested that dysregulation of ADK in astrocytes is a common pathologic hallmark of TLE. Moreover, in vitro data suggest the existence of an additional layer of modulatory crosstalk between the astrocyte-based adenosine cycle and inflammation. ADK also contributes to CK homeostasis in vivo. 

References
  • Aronica E, et al. (2011) Upregulation of adenosine kinase in astrocytes in experimental and human temporal lobe epilepsy. Epilepsia.52 (9): 1645-55.
  • Kuettel S, et al. (2011) Crystal structures of T. b. rhodesiense adenosine kinase complexed with inhibitor and activator: implications for catalysis and hyperactivation. PLoS Negl Trop Dis. 5 (5): e1164.
  • Cui XA, et al. (2011) Molecular characterization of Chinese hamster cells mutants affected in adenosine kinase and showing novel genetic and biochemical characteristics. BMC Biochem. 12 (1): 22.
  • Size / Price
    Catalog: MG51572-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"