Quick Order

Mouse TXNL4A Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
TXNL4AcDNA Clone Product Information
cDNA Size:429
cDNA Description:ORF Clone of Mus musculus thioredoxin-like 4A DNA.
Gene Synonym:Dim1, Txnl4, U5-15kD, U5-15kDa, D18Wsu98e, ENSMUSG00000057130
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

DIM1, also known as TXNL4A, is a member of the Dim protein family. The Dim protein family is composed of two classes, DIM1and Dim2, which share a common thioredoxin-like fold. They were originally identified for their role in cell cycle progression and have been found to interact with Prp6, an essential component of the spliceosome, which forms the bridge of U4/U6.U5-tri-snRNP. In spite of their biological and structural similarities, DIM1 and Dim2 proteins differ in many aspects. DIM1 bears distinctive structural motifs responsible for its interaction with other spliceosome components. Dim2 forms homodimers and contains specific domains required for its interactions with partners. This originality suggests that although both proteins are involved in pre-mRNA splicing, they are likely to be involved in different biological pathways. DIM1 interacts with HNRPF, HNRPH2, NEDD9/HEF1 and PQBP1/NPW38. It plays an essential role in pre-mRNA splicing.

  • Zhang Y, et al. (2001) Evidence that dim1 associates with proteins involved in pre-mRNA splicing, and delineation of residues essential for dim1 interactions with hnRNP F and Npw38/PQBP-1. Gene. 257 (1): 33-43.
  • Zhang YZ, et al. (2003) Structure, stability, and function of hDim1 investigated by NMR, circular dichroism, and mutational analysis. Biochemistry. 42(32):9609-18.
  • Zhang Y, et al. (2000) Evidence that dim1 associates with proteins involved in pre-mRNA splicing, and delineation of residues essential for dim1 interactions with hnRNP F and Npw38/PQBP-1. Gene. 257 (1):33-43.
  • Zhang YZ, et al. (2000) The evolutionarily conserved Dim1 protein defines a novel branch of the thioredoxin fold superfamily. Physiol Genomics. 1(3):109-18.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items