Quick Order

Mouse ARMETL1 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse CDNF cDNA Clone Product Information
NCBI RefSeq:NM_177647.4
RefSeq ORF Size:564bp
cDNA Description:Full length Clone DNA of Mus musculus arginine-rich, mutated in early stage tumors-like 1 with N terminal His tag.
Gene Synonym:CDNF, MGC129430, 9330140G23, Armetl1
Species:Mouse
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Background

Cerebral Dopamine Neurotrophic Factor (CDNF), also known as ARMETL1 (ARMET-like protein 1), is a secreted protein with eight conserved cysteine residues, predicting a unique protein fold and defining a new, evolutionarily conserved protein family. CDNF is a novel neurotrophic factor with strong trophic activity on dopaminergic neurons comparable to that of glial cell line-derived neurotrophic factor (GDNF). CDNF/ARMETL1 is a evolutionary conserved protein which can protect and restore the function of dopaminergic neurons in the rat model of Parkinson's disease, suggesting that CDNF might be beneficial for the treatment of Parkinson's disease. CDNF is widely expressed in neurons in several brain regions including cerebral cortex, hippocampus, substantia nigra, striatum and cerebellum. Human CDNF is glycosylated and secreted from transiently transfected cells. CDNF promotes the survival, growth, and function of dopamine-specific neurons and is expressed in brain regions that undergo cocaine-induced neuroplasticity.

References
  • Choi JM, et al. (2011) Analysis of mutations and the association between polymorphisms in the cerebral dopamine neurotrophic factor (CDNF) gene and Parkinson disease. Neurosci Lett. 493(3): 97-101.
  • Sun ZP, et al. (2011) Intracellular trafficking and secretion of cerebral dopamine neurotrophic factor in neurosecretory cells. J Neurochem. 117(1): 121-32.
  • Lohoff FW, et al. (2009) Association analysis between polymorphisms in the conserved dopamine neurotrophic factor (CDNF) gene and cocaine dependence. Neurosci Lett. 453(3): 199-203.
  • Lindholm P, et al. (2007) Novel neurotrophic factor CDNF protects and rescues midbrain dopamine neurons in vivo. Nature. 448(7149): 73-7.
  • Size / Price
    Catalog: MG50569-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"