Quick Order

Mouse PIK3IP1 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse PIK3IP1 cDNA Clone Product Information
Gene_bank_ref_id:NM_178149.4
RefSeq ORF Size:795bp
cDNA Description:Full length Clone DNA of Mus musculus phosphoinositide-3-kinase interacting protein 1 with N terminal Myc tag.
Gene Synonym:Crkd, Hgfl, RP23-191E3.6, 1500004A08Rik, 5830455E04Rik
Species:Mouse
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

PIK3IP1 contains 1 kringle domain and is a negative regulator of phosphatidylinositol-3-kinase (PI3K), suppresses the development of hepatocellular carcinoma. PI3K is a well-known regulator of cell division, motility, metabolism and survival in most cell types. Proper liver function and development highly depend on intact PI3K signal transduction. Aberrant PI3K pathway signaling in the liver is associated with hepatocellular carcinoma. PI3K signaling is involved in the homeostasis of lipid and glucose metabolism. Activation of the PI3K pathway induces lipogenesis and glycogenesis in the liver, since both Akt overexpressing transgenic mice and PTEN knockout mice develop fatty liver and hypoglycemia. PIK3IP1 overexpression can contribute to glucose homeostasis and fatty deposition.

References
  • He X, et al. (2008) PIK3IP1, a negative regulator of PI3K, suppresses the development of hepatocellular carcinoma. Cancer Res. 68(14):5591-8.
  • Gao P, et al. (2008) Both PIK3IP1 and its novel found splicing isoform, PIK3IP1-v1, are located on cell membrane and induce cell apoptosis. Beijing Da Xue Xue Bao. 40(6):572-7.
  • Zhu Z, et al. (2007) PI3K is negatively regulated by PIK3IP1, a novel p110 interacting protein. Biochem Biophys Res Commun. 358(1):66-72.
  • Size / Price
    Catalog: MG52429-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"