Quick Order

Mouse GPA33 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
GPA33cDNA Clone Product Information
Gene_bank_ref_id:NM_021610.1
cDNA Size:960
cDNA Description:ORF Clone of Mus musculus glycoprotein A33 (transmembrane) DNA.
Gene Synonym:BB116197, 2010310L10Rik, 2210401D16Rik, Gpa33
Species:Mouse
Vector:pCMV3-N-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Background

Cell surface A33 antigen, also known as glycoprotein A33, is a single-pass type I  membrane protein which is expressed in normal gastrointestinal epithelium and in 95% of colon cancers. GPA33 contains one Ig-like C2-type (immunoglobulin-like) domain and one Ig-like V-type (immunoglobulin-like) domain. The open reading frame encodes a 319-amino acid polypeptide having a putative secretory signal sequence and 3 potential glycosylation sites. The predicted mature protein has a 213-amino acid extracellular region, a single transmembrane domain, and a 62-amino acid intracellular tail. Intracellular traffic and recycling to the cell surface appear to play a major role in GPA33 function and to have an influence on its surface density superseding translational regulation. GPA33 has become a promising target of immunologic therapy strategies, but its biologic function and potential role in tumorigenesis are unknown. EpCAM protein and GPA33 mRNA expressions are specific and sensitive markers of Barrett's metaplasia (BM). GPA33 may also play a role in cell-cell recognition and signaling.

References
  • Heath J.K., et al., 1997, Proc. Natl. Acad. Sci. USA. 94:469-74.
  • Ritter G., et al., 1997, Biochem. Biophys. Res. Commun. 236:682-6.
  • Frey,D. et al., 2008, Cancer Biother Radiopharm  23 (1):65-73.
  • Rageul,J. et al., 2009, Int J Cancer 125 (12):2802-9. 
  • Size / Price
    Catalog:MG50559-NH
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"