After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human PROM1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PROM1cDNA Clone Product Information
Gene_bank_ref_id:BC012089
cDNA Size:2571
cDNA Description:ORF Clone of Homo sapiens prominin 1 DNA.
Gene Synonym:RP41, AC133, CD133, MCDR2, STGD4, CORD12, PROML1, MSTP061
Species:Human
Vector:pCMV3-N-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name
Background

CD133, also known as PROM1 and Prominin 1, is a pentaspan transmembrane glycoprotein which belongs to the prominin family. It localizes to membrane protrusions and is often expressed on adult stem cells. CD133 is known to play a role in maintaining stem cell properties by suppressing differentiation. CD133 binds cholesterol in cholesterol-containing plasma membrane microdomains. It is proposed to play a role in apical plasma membrane organization of epithelial cells. CD133 is also involved in regulation of MAPK and Akt signaling pathways. Mutations in PROM1 gene have been shown to result in retinitis pigmentosa and Stargardt disease. PROM1 gene is expressed from at least five alternative promoters that are expressed in a tissue-dependent manner. Expression of this gene is also associated with several types of cancer.

References
  • Corbeil D. et al., 2001, Biochem Biophys Res Commun. 285 (4): 939-44.
  • Horn PA. et al., 1999, Blood. 93 (4): 1435-37.
  • Sanai N. et al., 2005, N Engl J Med. 353 (8): 811-22.
  • Size / Price
    Catalog:HG15024-NY
    List Price: $395.00  (Save $0.00)
    Price:$395.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"