Quick Order

Mouse CFD ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse CFD cDNA Clone Product Information
NCBI RefSeq:NM_001291915.1
RefSeq ORF Size:777bp
cDNA Description:Full length Clone DNA of Mus musculus complement factor D (adipsin) with N terminal His tag.
Gene Synonym:DF, Adn, Cfd
Species:Mouse
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Mouse complement factor D, also known as Adipsin, C3 convertase activator, Properdin factor D and CFD is a secreted protein which belongs to the peptidase S1 family. CFD / Adipsin contains one peptidase S1 domain. Complement factor D ( CFD / Adipsin ) is a component of the alternative complement pathway best known for its role in humoral suppression of infectious agents. Complement factor D ( CFD / Adipsin ) has a high level of expression in fat, suggesting a role for adipose tissue in immune system biology. This protein is also a serine protease that is secreted by adipocytes into the bloodstream. Complement factor D ( CFD / Adipsin ) cleaves factor B when the latter is complexed with factor C3b, activating the C3bbb complex, which then becomes the C3 convertase of the alternate pathway. Its function is homologous to that of C1s in the classical pathway. Complement factor D ( CFD / Adipsin ) is a serine protease that stimulates glucose transport for triglyceride accumulation in fats cells and inhibits lipolysis. Defects in CFD / Adipsin are the cause of complement factor D deficiency (CFD deficiency) which predisposes to invasive meningococcal disease.

References
  • Volanakis JE, et al.,1996, Protein Sci. 5 (4): 553-64.
  • Searfoss,G.H et al., 2003, J Biol Chem. 278 (46):46107-16.
  • Ukkola,O. et al., 2003, Eur J Clin Nutr. 57 (9):1073-8.
  • Ronti T, et al., 2006, Clin. Endocrinol. (Oxf) 64 (4): 355-65.
  • Size / Price
    Catalog: MG50539-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"