After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Rat TTR Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
TTRcDNA Clone Product Information
cDNA Size:444
cDNA Description:ORF Clone of Rattus norvegicus transthyretin DNA.
Gene Synonym:Lr1, Tbpa
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

Prealbumin/Transthyretin, also known as ATTR, Prealbumin, TTR and PALB, is a secreted and cytoplasm protein which belongs to the Prealbumin / Transthyretin family. Prealbumin / Transthyretin is detected in serum and cerebrospinal fluid (at protein level). It is highly expressed in choroid plexus epithelial cells. It is also detected in retina pigment epithelium and liver. Each monomer of Prealbumin / Transthyretin has two 4-stranded beta sheets and the shape of a prolate ellipsoid. Antiparallel beta-sheet interactions link monomers into dimers. A short loop from each monomer forms the main dimer-dimer interaction. These two pairs of loops separate the opposed, convex beta-sheets of the dimers to form an internal channel. Prealbumin/Transthyretin is a carrier protein. It transports thyroid hormones in the plasma and cerebrospinal fluid, and also transports retinol (vitamin A) in the plasma. Defects in Prealbumin / Transthyretin are the cause of amyloidosis type 1 (AMYL1) which is a hereditary generalized amyloidosis due to Prealbumin / Transthyretin amyloid deposition. Protein fibrils can form in different tissues leading to amyloid polyneuropathies, amyloidotic cardiomyopathy, carpal tunnel syndrome, systemic senile amyloidosis. The diseases caused by mutations include amyloidotic polyneuropathy, euthyroid hyperthyroxinaemia, amyloidotic vitreous opacities, cardiomyopathy, oculoleptomeningeal amyloidosis, meningocerebrovascular amyloidosis, carpal tunnel syndrome, etc.

  • Westermark P, et al. (1990) Fibril in senile systemic amyloidosis is derived from normal transthyretin. Proc Natl Acad Sci U S A. 87(7): 2843-5.
  • Colon W, et al. (1992) Partial denaturation of transthyretin is sufficient for amyloid fibril formation in vitro. Biochemistry. 31(36): 8654-60.
  • Hammarstrm P, et al. (2003) Prevention of transthyretin amyloid disease by changing protein misfolding energetics. Science. 299(5607): 713-6.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items