Quick Order

Mouse FGF5 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse FGF5 cDNA Clone Product Information
Gene_bank_ref_id:NM_010203.4
RefSeq ORF Size:795bp
cDNA Description:Full length Clone DNA of Mus musculus fibroblast growth factor 5 with N terminal His tag.
Gene Synonym:go, Fgf-5, angora, Fgf5
Species:Mouse
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Cynomolgus FGF21 / Fibroblast Growth Factor 21 Protein (His Tag)Human / Cynomolgus FGF16 / FGF-16 ProteinHuman FGFR2 / CD332 Protein (ECD, His Tag)Mouse bFGF / FGF2 Protein (His Tag)Cynomolgus / Rhesus FGFR3 / CD333 Protein (His Tag)Human FGFR3 / CD333 Protein (alpha(IIIb), His Tag)Human FGFR2 / CD332 Protein (beta(IIIc), His Tag)Human FGFR3 / CD333 Protein (alpha(IIIb), Fc Tag)Human FGF7 / FGF-7 / KGF Protein (His Tag)Human FGFR2 / CD332 Protein (alpha(IIIb), Fc Tag)Human bFGF / FGF2 ProteinHuman aFGF / FGF1 ProteinHuman FGF9 Protein (Fc Tag)Human FGFR1 / CD331 Protein (His & Fc Tag)Human FGFR4 / FGF Receptor 4 Protein (Fc Tag)Human FGFR4 / FGF Receptor 4 Protein (His & Fc Tag)Human FGFR2 Protein (His & Fc Tag)Mouse FGFR3 / CD333 Protein (His & Fc Tag)Mouse FGFR4 / CD334 Protein (His Tag)Human FGFR1 / CD331 Protein (His Tag)Mouse FGFR4 / CD334 Protein (His & Fc Tag)Human FGF10 / KGF2 ProteinMouse / Rat aFGF / FGF1 ProteinMouse FGFR3 / CD333 Protein (His Tag)Human FGFR2 / CD332 Protein (His Tag)Mouse FGFRL1 / FGFR5 Protein (His Tag)Mouse FGF18 / FGF-18 Protein (His Tag)Mouse FGFR1 / CD331 Protein (His Tag)Mouse FGFR1 / CD331 Protein (Fc Tag)Human FGF21 Protein (His Tag)Human FGFR4 / FGF Receptor 4 Protein (His Tag)Mouse FGF21 / Fibroblast Growth Factor 21 Protein (His Tag)Human FGF18 / FGF-18 Protein (His Tag)Rat FGFR4 / FGF Receptor 4 Protein (Fc Tag)Human FGFR1 / CD331 Protein (His & GST Tag)Human FGF14 / SCA27 Protein (isoform 1B)Human FGFR2 / CD332 Protein (aa 400-821, His & GST Tag)Human FGFBP3 Protein (His Tag)Cynomolgus FGFR3 Protein (Fc Tag)Rat FGFR4 / FGF Receptor 4 Protein (His Tag)Human FGF19 ProteinHuman FGF17 ProteinRhesus FGFR4 / FGF Receptor 4 Protein (Fc Tag)Rhesus FGFR1 / CD331 Protein (Fc Tag)Mouse FGFR2 / CD332 Protein (Fc Tag)Human FGF6 / FGF-6 ProteinMouse FGFR2 / CD332 Protein (His Tag)Human FGFR1OP / FOP Protein (His & GST Tag)Cynomolgus aFGF / FGF1 ProteinCanine FGF12 ProteinCanine aFGF / FGF1 ProteinRhesus FGFR4 / FGF Receptor 4 Protein (His Tag)Rhesus FGFR1 / CD331 Protein (His Tag)Canine FGF14 / SCA27 ProteinCanine FGF9 / FGF-9 Protein (Fc Tag)Human FGFR3 / CD333 Protein (His Tag, ECD)Human FGFR3 / CD333 Protein (Fc Tag, ECD)Mouse FGF7 / FGF-7 / KGF Protein (His Tag)
Size / Price
Catalog: MG50513-NH
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"