Quick Order

Text Size:AAA

Mouse CD19 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse CD19 cDNA Clone Product Information
Gene_bank_ref_id:NM_009844.2
RefSeq ORF Size:1644bp
cDNA Description:Full length Clone DNA of Mus musculus CD19 antigen with N terminal His tag.
Gene Synonym:AW495831, Cd19
Species:Mouse
Vector:pCMV3-SP-N-His
Plasmid:pCMV3-His-mCD19
Restriction Site:HindIII + XbaI (6kb + 1.69kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. Cluster of differentiation 19 (CD19) is a member of CD system. CD19 is a cell surface molecule that assembles with the antigen receptor of B-cells. This results in a descent in threshold for antigen receptor-dependent stimulation. A simplified view holds that the ability of B-cells to respond to the various antigens in a specific and sensitive manner is achieved in the presence of low-affinity antigen receptors. CD19 primarily acts as a B-cell coreceptor in conjunction with CD21 and CD81. The formation of the receptor complex is induced by antigen and CD19, induced by exogenous antigen, has been found cytoplasmic tail phosphorylated and bind to sIg.

References
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Carter RH, et al. (1992) CD19: lowering the threshold for antigen receptor stimulation of B lymphocytes. Science. 256 (5053): 105-7.
  • Size / Price
    Catalog: MG50510-NH
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn StockShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"