Quick Order

Mouse Neuropilin-1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
NRP1cDNA Clone Product Information
Gene_bank_ref_id:NM_008737.1
cDNA Size:2772
cDNA Description:ORF Clone of Mus musculus Neuropilin 1 DNA.
Gene Synonym:Nrp, NP-1, Npn1, NPN-1, C530029I03, Nrp1
Species:Mouse
Vector:pCMV3-N-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Vascular Endothelial Growth Factor (VEGF) & Receptor Related Products
Product nameProduct name
Cynomolgus Neuropilin-1 / NRP1 Protein (Fc Tag)Cynomolgus Neuropilin-1 / NRP1 ProteinHuman VEGFR1 / FLT-1 Protein (Fc Tag)Human PIGF / PLGF Protein (Fc Tag)Cynomolgus Neuropilin-1 / NRP1 / CD304 Protein (His Tag)Human VEGF121 / VEGF-A ProteinHuman Neuropilin-1 / NRP1 Protein (Fc Tag)Human Neuropilin-1 / NRP1 / CD304 Protein (His Tag)Human VEGFR2 / Flk-1 / CD309 / KDR Protein (Fc Tag)Human VEGFR2 / Flk-1 / CD309 / KDR Protein (His Tag)Human VEGFR2 / Flk-1 / CD309 / KDR Protein (His & GST Tag)Human VEGFR1 / FLT-1 Protein (His Tag)Human VEGF-C Protein (His Tag)Human VEGF-D / VEGFD / FIGF Protein (His Tag)Human Neuropilin 2 / NRP2 Protein (Fc Tag)Human Neuropilin-2 / NRP2 Protein (His Tag)Human VEGFR3 / FLT4 Protein (Fc Tag)Human VEGFR3 / FLT4 Protein (His Tag)Human VEGFR1 / FLT-1 Protein (His Tag)Human / Cynomolgus VEGF / VEGFA / VEGF165 ProteinHuman / Cynomolgus VEGF / VEGFA / VEGF165 ProteinHuman VEGF-B / VEGFB Protein (Fc Tag)Human VEGF121 / VEGF-A ProteinHuman VEGF121b / VEGF-A ProteinMouse PIGF / PLGF Protein (Fc Tag)Mouse PIGF / PLGF ProteinMouse VEGF-D / VEGFD / FIGF Protein (Fc Tag)Mouse VEGF-D / VEGFD / FIGF Protein (His Tag)Mouse VEGFA / VEGF164 ProteinMouse VEGFR3 / FLT-4 Protein (Fc Tag)Mouse VEGFR3 / FLT-4 Protein (His Tag)Mouse VEGFR2 / Flk-1 / CD309 / KDR Protein (Fc Tag)Mouse VEGFR2 / Flk-1 / CD309 / KDR Protein (His Tag)Danio rerio (zebrafish) VEGF / VEGFA / VEGF165 ProteinCanine VEGF / VEGFA ProteinRat VEGF164 / VEGFA ProteinRat VEGFR1 / FLT-1 Protein (His Tag)Rat VEGFC / VEGF-C Protein (aa 108-223, Fc Tag)Rat VEGFC / VEGF-C Protein (aa 108-223, His Tag)Rat VEGF-D / VEGFD / FIGF Protein (Fc Tag)Rat VEGFR2 / Flk-1 / CD309 / KDR Protein (Fc Tag)Rat VEGFR2 / Flk-1 / CD309 / KDR Protein (His Tag)
Background

Neuropilin is a type I transmembrane protein and the molecular mass is 120 kDa. Two homologues, Neuropilin-1 and Neuropilin-2, are identified. The primary structure of Neuropilin-1 and Neuropilin-2 is well conserved and is divided into four domains, CUB (a1/a2) domain, FV/FVIII (b1/b2) domain, MAM (c) domain, and (d) domain that contains a transmembrane and a short cytoplasmic region. Neuropilin-1 (NRP1) acts as a receptor for two different extracellular ligands, class 3 semaphorins and specific isoforms of vascular endothelial growth factor. The functions of NRP1 and NRP2 have been extensively studied in neurons where they act in axon guidance and in endothelial cells where they promote angiogenesis and cell migration. Neuropilin-1 is likely to mediate contacts between the dendritic cells and the T lymphocytes via homotypic interactions and is essential for the initiation of the primary immune response. NRP1 is a co-receptor for VEGF receptor-2 (VEGFR2) that enhances the binding of VEGF165 to VEGFR2 and VEGF165-mediated chemotaxis. NRP1 expression is regulated in EC by tumor necrosis factor-alpha, the transcription factors dHAND and Ets-1, and vascular injury. NRP1 upregulation is positively correlated with the progression of various tumors. Overexpression of NRPI in rat tumor cells results in enlarged tumors and substantially enhanced tumor angiogenesis. On the other hand, soluble NRP1 (sNRP1) is an antagonist of tumor angiogenesis.

References
  • Nakamura F, et al. (2002) Structural and functional relation of neuropilins. Adv Exp Med Biol. 515: 55-69.
  • Romeo PH, et al. (2002) Neuropilin-1 in the immune system. Adv Exp Med Biol. 515: 49-54.
  • Klagsbrun M, et al. (2002) The role of neuropilin in vascular and tumor biology. Adv Exp Med Biol. 515: 33-48.
  • Staton CA, et al. (2007) Neuropilins in physiological and pathological angiogenesis. J Pathol. 212(3): 237-48.
  • Bagri A, et al. (2009) Neuropilins in tumor biology. Clin Cancer Res. 15(6): 1860-4.
  • Size / Price
    Catalog:MG50509-NH
    List Price: $395.00  (Save $0.00)
    Price:$395.00      [How to order]
    Availability2-3 weeks
    Images
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"