After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse MAPRE3 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse MAPRE3 cDNA Clone Product Information
Gene_bank_ref_id:NM_133350.1
RefSeq ORF Size:846bp
cDNA Description:Full length Clone DNA of Mus musculus microtubule-associated protein, RP/EB family, member 3 with C terminal His tag.
Gene Synonym:EB2, EB3, AI790651
Species:Mouse
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

MAPRE3, also known as EB3, is a member of the RP/EB family. MAPRE3 localizes to the cytoplasmic microtubule network and binds APCL. MAPRE3 regulates the dynamics of the microtubule cytoskeleton. It also promotes microtubule growth. MAPRE3 may be involved in spindle function by stabilizing microtubules and anchoring them at centrosomes. MAPRE3 may also play a role in cell migration.

References
  • Rual JF. et al., 2005, Nature. 437 (7062): 1173-8.
  • Yeh TY. et al., 2005, J Cell Sci. 118 (15): 3431-43.
  • Mimori-Kiyosue Y. et al., 2005, J Cell Biol. 168 (1): 141-53.
  • Size / Price
    Catalog: MG51507-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"