Quick Order

Text Size:AAA

Mouse ENTPD5 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ENTPD5cDNA Clone Product Information
Gene_bank_ref_id:NM_001026214.1
cDNA Size:1284
cDNA Description:ORF Clone of Mus musculus ectonucleoside triphosphate diphosphohydrolase 5 DNA.
Gene Synonym:Pcph, Cd39l4, mNTPase, AI196558, AI987697, NTPDase5, ER-UDPase, NTPDase-5, Entpd5
Species:Mouse
Vector:pCMV3-N-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-His Vector Information
 
Vector Name pCMV3-N-His
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-His Physical Map

Schematic of pCMV3-N-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Background

Ectonucleoside triphosphate diphosphohydrolase 5 (ENTPD5), also known as CD39 antigen-like 4, ER-UDPase, Guanosine-diphosphatase ENTPD5, Nucleoside diphosphatase Uridine-diphosphatase ENTPD5. This hydrolase is expressed in response to phosphoinositide 3-kinase (PI3K) signaling. Activation of PI3K results in FOXO phosphorylation by AKT1 and loss of ENTPD5 transcriptional repression. It is Up-regulated in PTEN-deficient cells. Uridine diphosphatase (UDPase) that promotes protein N-glycosylation and ATP level regulation.ENTPD5 promotes protein N-glycosylation and folding in the endoplasmic reticulum, as well as elevated ATP consumption in the cytosol via an ATP hydrolysis cycle. Together with CMPK1 and AK1, ENTPD5 constitutes an ATP hydrolysis cycle that converts ATP to AMP and results in a compensatory increase in aerobic glycolysis. ENTPD5 also hydrolyzes GDP and IDP but not any other nucleoside di-, mono- or triphosphates, nor thiamine pyrophosphate. This enzyme Plays a key role in the AKT1-PTEN signaling pathway by promoting glycolysis in proliferating cells in response to phosphoinositide 3-kinase (PI3K) signaling.

References
  • Villar J, et al. (2009) PCPH/ENTPD5 expression confers to prostate cancer cells resistance against cisplatin-induced apoptosis through protein kinase Calpha-mediated Bcl-2 stabilization. Cancer Res. 69(1): 102-10.
  • Fang M, et al. (2010) The ER UDPase ENTPD5 promotes protein N-glycosylation, the Warburg effect, and proliferation in the PTEN pathway. Cell. 143(5): 711-24.
  • Paez JG, et al. (2001) Identity between the PCPH proto-oncogene and the CD39L4 (ENTPD5) ectonucleoside triphosphate diphosphohydrolase gene. Int J Oncol. 19(6): 1249-54.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"