After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse POSTN Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
POSTNcDNA Clone Product Information
Gene_bank_ref_id:NM_015784.2
cDNA Size:2436
cDNA Description:ORF Clone of Mus musculus periostin, osteoblast specific factor DNA.
Gene Synonym:PN, Osf2, peri, OSF-2, AI747096, Periostin
Species:Mouse
Vector:pCMV3-N-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Background

Periostin ( POSTN ), also known as OSF2 (osteoblast specific factor 2), is a heterofunctional secreted extracellular matrix (ECM) protein comprised of four fasciclin domains that promotes cellular adhesion and movement, as well as collagen fibrillogenesis. Postn is expressed in unique growth centers during embryonic development where it facilitates epithelial-mesenchymal transition (EMT) of select cell populations undergoing reorganization. In the adult, Postn expression is specifically induced in areas of tissue injury or areas with ongoing cellular re-organization. In the adult heart Postn is induced in the ventricles following myocardial infarction, pressure overload stimulation, or generalized cardiomyopathy. Although the detailed function of Postn is still unclear, Postn-integrin interaction is thought to be involved in tumor development. Postn is frequently overexpressed in various types of human cancers, stimulating metastatic growth by promoting cancer cell survival, invasion and angiogenesis, and can be a useful marker to predict the behavior of cancer.

References
  • Kudo,Y. et al., 2007, Histol Histopathol. 22 (10):1167-1174.
  • Li, J.S. et al., 2007, World J Gastroenterol. 13 (39): 5261-5266.
  • Oku, E. et al., 2008, Int J Hematol. 88 (1): 57-63.
  • Hamilton, D.W. et al., 2008, J Cell Commun Signal. 2(1-2):9-17.
  • Puglisi, F.J et al., 2008, Clin Pathol. 61 (4): 494-498.
  • Conway, S. J. et al., 2008, Curr Genomics. 9 (8): 548-555.
  • Size / Price
    Catalog:MG50450-NH
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"