Quick Order

Text Size:AAA

Rat KLK13 ORF mammalian expression plasmid, C-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat KLK13 cDNA Clone Product Information
Gene_bank_ref_id:NM_001170405.1
RefSeq ORF Size:831bp
cDNA Description:Full length Clone DNA of Rattus norvegicus kallikrein related-peptidase 13 with C terminal Flag tag.
Gene Synonym:Klk13
Species:Rat
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Human tissue kallikrein 13 (hK13), also known as KLK-L4 (kallikrein-like gene 4), is a member of the human tissue kallikrein family of serine proteases having diverse physiological functions in many tissues. The KLK13 gene resides on chromosome 19q13.3-4 along with other 14 members in a gene cluster and shares a high degree of homology. KLK13 is a trypsin-like, secreted serine protease expressed specifically in the testicular tissue including prostate, salivary gland, breast, and testis. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and may play a role in metastasis. KLK13 may be involved in the pathogenesis and/or progression of breast and ovary cancers, and is regarded as a novel cancer biomarker. In addition, KLK13 interacts and forms complexes with several serum protease inhibitors, such as alpha2-macroglobulin, and its expression is regulated by steroid hormones.

Size / Price
Catalog: RG80544-CF
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"