After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse MSTN ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse MSTN cDNA Clone Product Information
Gene_bank_ref_id:NM_010834.2
RefSeq ORF Size:1131bp
cDNA Description:Full length Clone DNA of Mus musculus myostatin with N terminal His tag.
Gene Synonym:Cmpt, Gdf8, MGC124261, MGC124262, MGC124263, Mstn
Species:Mouse
Vector:pCMV3-SP-N-His
Plasmid:pCMV3-His-mMSTN
Restriction Site:KpnI + XbaI (6kb + 1.15kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Mouse MSTN Gene Plasmid Map
Mouse MSTN ORF mammalian expression plasmid, N-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Background

GDF-8 / Myostatin / MSTN is a member of the bone morphogenetic protein (BMP) family and the TGF-beta superfamily. This group of proteins is characterized by a polybasic proteolytic processing site which is cleaved to produce a mature protein containing seven conserved cysteine residues. The members of this family are regulators of cell growth and differentiation in both embryonic and adult tissues. GDF-8 / Myostatin / MSTN is highly expressed in skeletal muscle, and myostatin loss-of-function leads to doubling of skeletal muscle mass. Experiments in mice have improved that GDF-8 / Myostatin / MSTN is a key regulator of mesenchymal stem cell proliferation and differentiation, and mice lacking Myostatin encoding gene show decreased body fat and a generalized increase in bone density and strength. The increase in bone density is observed in most anatomical regions, including the limbs, spine, and jaw, and myostatin inhibitors have been observed to significantly increase bone formation. GDF-8 / Myostatin / MSTN is also expressed in the early phases of fracture healing, and GDF-8 / Myostatin / MSTN deficiency leads to increased fracture callus size and strength. Together, these data suggest that GDF-8 / Myostatin / MSTN has direct effects on the proliferation and differentiation of osteoprogenitor cells, and that GDF-8/Myostatin/MSTN antagonists and inhibitors are likely to enhance both muscle mass and bone strength.

References
  • Elkasrawy MN, et al. (2010) Myostatin (GDF-8) as a key factor linking muscle mass and bone structure. J Musculoskelet Neuronal Interact. 10(1): 56-63.
  • Kambadur R, et al. (1997) Mutations in myostatin (GDF8) in double-muscled Belgian Blue and Piedmontese cattle. Genome Res. 7 (9): 910-6.
  • McPherron AC, et al. (1997) Regulation of skeletal muscle mass in mice by a new TGF-beta superfamily member. Nature. 387 (6628): 83-90.
  • Size / Price
    Catalog: MG50441-NH
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn StockShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"