Quick Order

Mouse CFL1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CFL1cDNA Clone Product Information
cDNA Size:501
cDNA Description:ORF Clone of Mus musculus cofilin 1, non-muscle DNA.
Gene Synonym:Cof, AA959946
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

CFL1, also known as n-cofilin, is a member of the ADF/Cofilin family. This family comprises three genes: CFL1, CFL2 and DSTN (destrin). ADF/Cofilin family members bind G-actin monomers and depolymerize actin filaments through two mechanisms: severing and increasing the off-rate for actin monomers from the pointed end. Cofilin also binds with other proteins such as myosin, tropomyosin, α-actinin, gelsolin and scruin. These proteins compete with cofilin for actin binding. Сofilin also plays a role in innate immune response. CFL1 contains 1 ADF-H domain and is widely distributed in various tissues. It is important for normal progress through mitosis and normal cytokinesis.

  • Lappalainen P. et al., 1997, Nature. 388 (6637): 78-82.
  • Ichetovkin I. et al., 2000, Cell Motil. 45 (4): 293-306.
  • Carlier MF. et al., 1997, J Cell Biol. 136 (6): 1307-22.