After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse S100A5 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
S100A5cDNA Clone Product Information
Gene_bank_ref_id:NM_011312.2
cDNA Size:282
cDNA Description:ORF Clone of Mus musculus S100 calcium binding protein A5 DNA.
Gene Synonym:S100D9, S100a5
Species:Mouse
Vector:pCMV3-N-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-His Vector Information
 
Vector Name pCMV3-N-His
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-His Physical Map

Schematic of pCMV3-N-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Background

S100 protein?is a family of low molecular weight protein found in vertebrates characterized by two?EF-hand calcium-binding motifs. There are at least 21 different S100 proteins, and the name is derived from the fact that the protein is?100%?soluble in ammonium sulfate?at neutral?pH. Most S100 proteins are disulfide-linked homodimer, and is normally present in cells derived from the?neural crest, chondrocytes, macrophages, dendritic cells, etc. S100 proteins have been implicated in a variety of intracellular and extracellular functions. They are involved in regulation of protein phosphorylation, transcription factors, the dynamics of cytoskeleton constituents, enzyme activities, cell growth and differentiation, and the inflammatory response.?? Protein S100-A5, also known as Protein S-100D, S100 calcium-binding protein A5, S100A5 and S100D, is a member of the S100 family which contains two?EF-hand domains. S100A5 is also a novel member of the EF-hand superfamily of calcium-binding proteins that is poorly characterized at the protein level. It is expressed in very restricted regions of the adult brain. From birth onwards, S100A5 remained a neuronal-specific protein, only located in a subpopulation of neurons in the spiral ganglion.

References
  • Sch?fer,B.W. et al., 2000, J Biol Chem. 275 (39):30623-30.
  • Gebhardt, C. et al., 2006, Biochem Pharmacol. 72 (11):1622-31.
  • Nonaka, D. et al., 2008, J. Cutan. Pathol. 35 (11): 1014-9.
  • Lim, SY. et al., 2008, J Immunol. 181 (8): 5627-36.
  • Heibeck TH. et al., 2009, J. Proteome Res. 8:3852-61.
  • Size / Price
    Catalog:MG50427-NH
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"