After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Rat PARK7 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PARK7cDNA Clone Product Information
cDNA Size:570
cDNA Description:ORF Clone of Rattus norvegicus parkinson protein 7 DNA.
Gene Synonym:Dj1, CAP1, DJ-1, SP22
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

Parkinson's disease locus DJ-1 (PARK7) is a differentially expressed transcript. DJ-1 plays a physiologic role in protection of erythroid cells from oxidant damage, a function unmasked in the context of oxidative stress. PARK7 belongs to the peptidase C56 family of proteins. It acts as a positive regulator of androgen receptor-dependent transcription. It may also function as a redox-sensitive chaperone, as a sensor for oxidative stress, and it apparently protects neurons against oxidative stress and cell death. Mutations in the DJ-1 gene are associated with rare forms of autosomal recessive early-onset Parkinson's disease (PD). DJ-1/p53 interactions contribute to apoptosis resistance in clonal myeloid cells and may serve as a prognostic marker in patients with myelodysplastic syndromes (MDS). DJ-1 regulates redox signaling kinase pathways and acts as a transcriptional regulator of antioxidative gene batteries. Therefore, DJ-1 is an important redox-reactive signaling intermediate controlling oxidative stress after ischemia, upon neuroinflammation, and during age-related neurodegenerative processes. Augmenting DJ-1 activity might provide novel approaches to treating chronic neurodegenerative illnesses such as Parkinson's disease and acute damage such as stroke.

  • Takahashi K, et al. (2001). DJ-1 positively regulates the androgen receptor by impairing the binding of PIASx alpha to the receptor. J. Biol. Chem. (United States). 276 (40): 37556-63.
  • Niki, Takeshi, et al. (2003). DJBP: a novel DJ-1-binding protein, negatively regulates the androgen receptor by recruiting histone deacetylase complex, and DJ-1 antagonizes this inhibition by abrogation of this complex. Mol. Cancer Res. (United States). 1 (4): 247-61.
  • Kahle PJ, et al. (2009) DJ-1 and prevention of oxidative stress in Parkinson's disease and other age-related disorders. Free Radic Biol Med. 47(10): 1354-61.
  • Xu X, et al. (2010) The familial Parkinson's disease gene DJ-1 (PARK7) is expressed in red cells and plays a role in protection against oxidative damage. Blood Cells Mol Dis. 45(3): 227-32.
  • Marcondes AM, et al. (2010) Identification of DJ-1/PARK-7 as a determinant of stroma-dependent and TNF-alpha-induced apoptosis in MDS using mass spectrometry and phosphopeptide analysis. Blood. 115(10): 1993-2002.