After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human SCLY ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SCLY cDNA Clone Product Information
Gene_bank_ref_id:BC007891
RefSeq ORF Size:1338bp
cDNA Description:Full length Clone DNA of Homo sapiens selenocysteine lyase with N terminal HA tag.
Gene Synonym:SCL, hSCL
Species:Human
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

SCLY, also known as selenocysteine lyase, belongs to the class-V pyridoxal-phosphate-dependent aminotransferase family. It is a novel enzyme that exclusively decomposes L-selenocysteine into L-alanine and H2Se in various mammalian tissues. SCLY contains pyridoxal 5'-phosphate and weighs approximately 85,000. SCLY participates in selenoamino acid metabolism. It employs one cofactor, pyridoxal phosphate. Its maximum reactivity is at about pH 9.0. It was shown that 1 mol of selenocysteine is converted to equimolar amounts of alanine and H2Se. The following amino acids are insert: L-cysteine, L-serine, L-cysteine sulfinate, selenocysteamine, Se-ethyl-DL-selenocysteine, and L-selenohomocysteine. L-Cysteine (Ki, 1.0 mM) competes with L-selenocysteine (Km, 0.83mM) to inhibit the enzyme reaction.

References
  • Johansson AL. et al., 2012, PLoS One. 7 (1): e30528.
  • Collins R. et al., 2012, PLoS One. 7 (1): e30581.
  • N Esaki. et al., 1982, The Journal of Biological Chemistry. 257: 4386-91.
  • Size / Price
    Catalog: HG14905-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"