After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Rat FABP7 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
FABP7cDNA Clone Product Information
cDNA Size:399
cDNA Description:ORF Clone of Rattus norvegicus fatty acid binding protein 7, brain DNA.
Gene Synonym:Fabp7
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

BLBP, also known as FABP7, is a brain fatty acid binding protein. Fatty acid binding proteins (FABPs) are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands. FABP7 binds DHA with the highest affinity among all of the FABPs. FABPs may play roles in fatty acid uptake, transport, and metabolism. BLBP is expressed, during development, in radial glia by the activation of notch receptors. It was shown that reelin induces FABP7 expression in neural progenitor cells via notch-1 activation. BLBP variation is linked to weak prepulse inhibition(PPI) in mice and deficit in PPI is an endophenotypic trait observed in schizophrenia patients and their relatives.

  • Shi YE, et al. (1997) Antitumor activity of the novel human breast cancer growth inhibitor, mammary-derived growth inhibitor-related gene, MRG. Cancer Res. 57(15):3084-91.
  • Young JK, et al. (1997) Immunoreactivity for brain-fatty acid binding protein in gomori-positive astrocytes. Glia. 16(3):218-26.
  • Xu LZ, et al. (1996) Ligand specificity of brain lipid-binding protein. J Biol Chem. 271(40): 24711-9.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items