After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse SMPDL3A Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SMPDL3AcDNA Clone Product Information
Gene_bank_ref_id:NM_020561.2
cDNA Size:1338
cDNA Description:ORF Clone of Mus musculus sphingomyelin phosphodiesterase, acid-like 3A DNA.
Gene Synonym:ASM3A, ASML3, ASML3A, AI529588, 0610010C24Rik
Species:Mouse
Vector:pCMV3-N-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name
Background

SMPDL3A gene is a novel liver X receptor (LXR) -regulated gene, with an LXR response element within its promoter. The induction of SMPDL3A is LXR-dependent and is restricted to human blood cells with no induction observed in mouse cellular systems. LXR α and LXRβ function as physiological sensors of cholesterol metabolites (oxysterols), regulating key genes involved in cholesterol and lipid metabolism. LXRs have been extensively studied in both human and rodent cell systems, revealing their potential therapeutic value in the contexts of atherosclerosis and inflammatory diseases. The LXR genome landscape has been investigated in murine macrophages but not in human THP-1 cells, which represent one of the frequently used monocyte/macrophage cell systems to study immune responses.

References
  • Wright KO, et al. (2002) Increased expression of the acid sphingomyelinase-like protein ASML3a in bladder tumors. J Urol. 168(6):2645-9.
  • Strausberg RL, et al. (2002) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Mungall AJ, et al. (2003) The DNA sequence and analysis of human chromosome 6. Nature. 425(6960):805-11.
  • Size / Price
    Catalog:MG52271-NM
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"