After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse PRL Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PRLcDNA Clone Product Information
cDNA Size:687
cDNA Description:ORF Clone of Mus musculus prolactin DNA.
Gene Synonym:Prl1a1, AV290867, Prl
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
  • Jara LJ, et al. (2011) Prolactin and autoimmunity. Clin Rev Allergy Immunol. 40(1): 50-9.
  • Urban A, et al. (2007) Prolactin as a factor for increased platelet aggregation. Neuro Endocrinol Lett. 28(4): 518-23.
  • Charoenphandhu N, et al. (2007) Prolactin is an important regulator of intestinal calcium transport. Can J Physiol Pharmacol. 85(6): 569-81.
  • Tworoger SS, et al. (2006) Prolactin and breast cancer risk. Cancer Lett. 243(2): 160-9.
  • Ben-Jonathan N, et al. (2006) Focus on prolactin as a metabolic hormone. Trends Endocrinol Metab. 17(3): 110-6.