After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse CAMKV Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CAMKVcDNA Clone Product Information
cDNA Size:1539
cDNA Description:ORF Clone of Mus musculus CaM kinase-like vesicle-associated DNA.
Gene Synonym:1G5, BB074618, BC017634
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-Myc Vector Information
Vector Name pCMV3-N-Myc
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-Myc Physical Map

Schematic of pCMV3-N-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

CaM kinase-like vesicle-associated protein, also known as CAMKV, is a peripheral membrane protein and Cytoplasmic vesicle membrane protein which belongs to the protein kinase superfamily and CAMK Ser/Thr protein kinase family. CAMKV contains one protein kinase domain. It is predominantly observed in association with the plasma membrane of soma and in neurites, both axons and dendrites. CAMKV may be associated with vesicular structures. It does not appear to have detectable kinase activity.

Protein kinases are a group of enzymes that move a phosphate group onto proteins, in a process called phosphorylation. Protein kinases function as an on/off switch for many cellular processes, including metabolism, transcription, cell cycle progression, cytoskeletal rearrangement and cell movement, apoptosis, and differentiation. They also function in embryonic development, physiological responses, and in the nervous and immune system. Abnormal phosphorylation causes many human diseases, including cancer, and drugs that affect phosphorylation can treat those diseases. The protein kinase domain is a structurally conserved protein domain containing the catalytic function of protein kinases. Protein kinases play a role in a mulititude of cellular processes, including division, proliferation, apoptosis, and differentiation. Phosphorylation usually results in a functional change of the target protein by changing enzyme activity, cellular location, or association with other proteins.

  • Hunter T, et al.,1988, Science. 241 (4861): 42-51.
  • Wiemann S., et al., 2001, Genome Res. 11:422-435.
  • G. Manning, et al., 2002, Science 6. 298:1912-1934.
  • Manning G, et al.,2002, Science. 298 (5600): 1912-34.
  • Ota T., et al., 2004, Nat. Genet. 36:40-45.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items