Quick Order

Mouse ITK Kinase ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse ITK cDNA Clone Product Information
NCBI RefSeq:NM_010583.2
RefSeq ORF Size:1860bp
cDNA Description:Full length Clone DNA of Mus musculus IL2-inducible T-cell kinase with N terminal His tag.
Gene Synonym:Emt, Tsk, Tcsk, Itk
Species:Mouse
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

IL-2-inducible T cell kinase is a member of the protein kinase superfamily, Tyr protein kinase family and TEC subfamily. It contains 1 Btk-type zinc finger, 1 PH domain, 1 protein kinase domain, 1 SH2 domain and 1 SH3 domain. As an intracellular kinase which expressed in T-cells, IL-2-inducible T cell kinase contains both SH2 and SH3 domains which are often found in intracellular kinases. It is hought to play a role in T-cell proliferation and differentiation. It regulates the development, function and differentiation of conventional T-cells and nonconventional NKT-cells. IL-2-inducible T cell kinase also plays an essential role in regulation of the adaptive immune response. efects in IL-2-inducible T cell kinase are the cause of lymphoproliferative syndrome EBV-associated autosomal type 1 (LPSA1). LPSA1 is a rare immunodeficiency characterized by extreme susceptibility to infection with Epstein-Barr virus (EBV). Inadequate immune response to EBV can have a fatal outcome. Clinical features include splenomegaly, lymphadenopathy, anemia, thrombocytopenia, pancytopenia, recurrent infections. There is an increased risk for lymphoma.

References
  • Lee SH, et al. (2011) The association of a single-nucleotide polymorphism of the IL-2 inducible T-cell Kinase gene with asthma. Ann Hum Genet. 75(3):359-69.
  • Yao HL, et al. (2010) Effect of Itk down regulation on cytokines production in Jurkat cell. Zhonghua Shi Yan He Lin Chuang Bing Du Xue Za Zhi. 24(5):358-61.
  • Pechloff K, et al. (2010) The fusion kinase ITK-SYK mimics a T cell receptor signal and drives oncogenesis in conditional mouse models of peripheral T cell lymphoma. J Exp Med. 207(5):1031-44.
  • Size / Price
    Catalog: MG50361-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"