After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse BID ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse BID cDNA Clone Product Information
Gene_bank_ref_id:NM_007544.3
RefSeq ORF Size:588bp
cDNA Description:Full length Clone DNA of Mus musculus BH3 interacting domain death agonist with N terminal His tag.
Gene Synonym:AI875481, AU022477, 2700049M22Rik, Bid
Species:Mouse
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

The BH3 interacting domain death agonist (BID) is a pro-apoptotic member of the Bcl-2 protein family, which contains only the BH3 domain, and is required for its interaction with the Bcl-2 family proteins and for its pro-death activity. BID is important to cell death mediated by these proteases and thus is the sentinel to protease-mediated death signals. Recent studies further indicate that Bid may be more than just a killer molecule, it could be also involved in the maintenance of genomic stability by engaging at mitosis checkpoint. BID is an integrating key regulator of the intrinsic death pathway that amplifies caspase-dependent and caspase-independent execution of neuronal apoptosis. Therefore pharmacological inhibition of BID provides a promising therapeutic strategy in neurological diseases where programmed cell death is prominent. BID is activated by Caspase 8 in response to Fas/TNF-R1 death receptor activation. Activated BID is translocated to mitochondria and induces cytochrome c release, which in turn activates downstream caspases. BID action has been proposed to involve the mitochondrial re-location of its truncated form, tBid, to facilitate the release of apoptogenic proteins like cytochrome c.

Size / Price
Catalog: MG50351-NH
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"